DNA simulation set-up with AMBER

I have been working on the structure and dynamics of single and double stranded DNA for some time now and below is a write up of an easy way to setup the simulations using the AMBER suite of software. Along with primary executables sander, pmemd, tleap and ptraj, AMBER comes with a number of other useful tools. One such tool is the nucleic acid builder (or nab). To create a 10mer poly-Adenosine poly-Thymidine, put the following text in a file called nuc.nab;

molecule m;
m = fd_helix( "abdna", "aaaaaaaaaa", "dna" );
putpdb( "nuc.pdb", m, "-wwpdb");

Then run these in the terminal

nab nuc.nab
./a.out

You should get a nuc.pdb file which contains the poly A-T double stranded DNA. Everything so far is available in more detail at http://ambermd.org/tutorials/basic/tutorial1/section2.htm

To get a single stranded poly-A DNA simply delete the lines corresponding to poly-T. To create stem-loop type configurations commonly found in RNA, do the following. Say you want the ssDNA

AAATAGAGCTAGTGAGGATTT

with the first 4 bp [AAAT] paired with the last 4 [TTTA or ATTT if you want to read from above]. For this I simply generate a double stranded DNA like so...

AAATAGAGCTAGTGAGGATTT
TTTATCTCGATCACTCCTAAA

Then delete the bases shown in red from the PDB file.

AAATAGAGCTAGTGAGGATTT
TTTATCTCGATCACTCCTAAA

Now you should have

AAATAGAGCTAGTGAGG
TTTA

This is the same as AAATAGAGCTAGTGAGGATTT but with the ends paired up. For the stem-loop conformation you should be able to use the parameter and topology files generated for the fully stretched single stranded DNA. You will have a long bond between  AAATAGAGCTAGTGAGG--and--ATTT. But this can be easily fixed with a quick minimization.