Accomplishing that is trivial in any OS but it is a good idea to do it once in a while to break the monotony and keep things fresh.
This web log is my online notebook for software tips and hacks to make my life and hopefully that of someone else just a little bit easy. Should you find any mistakes or have any useful suggestions, please do not hesitate to write to me. Peace! Pavan Ghatty
Saturday, January 25, 2014
Tuesday, January 21, 2014
Calculating Rg using VMD
I am working on a system with 60 copies of a molecule which has 1287 atoms in it. The script below loads the trajectory and calculates the radius of gyration of each copy.
mol new system.gro
for {set num 0} {$num < 201} {incr num} {
mol addfile cen_md_$num.xtc waitfor all
}
for {set i 1} {$i <61} {incr i} {
set start [expr 1 + 1287 * ($i-1) ]
set end [expr 1287 * $i]
puts "$start $end"
set sel [atomselect top "serial $start to $end"]
set filename [open "rg-dextran-number-$i.txt" w]
puts "Number of frames is [molinfo top get numframes]";
for {set frame 0} {$frame < [molinfo top get numframes]} {incr frame} {
animate goto $frame
$sel update
puts $filename [format "%8.3f" [measure rgyr $sel]]
}
close $filename
}
quit
61>
for {set num 0} {$num < 201} {incr num} {
mol addfile cen_md_$num.xtc waitfor all
}
for {set i 1} {$i <61} {incr i} {
set start [expr 1 + 1287 * ($i-1) ]
set end [expr 1287 * $i]
puts "$start $end"
set sel [atomselect top "serial $start to $end"]
set filename [open "rg-dextran-number-$i.txt" w]
puts "Number of frames is [molinfo top get numframes]";
for {set frame 0} {$frame < [molinfo top get numframes]} {incr frame} {
animate goto $frame
$sel update
puts $filename [format "%8.3f" [measure rgyr $sel]]
}
close $filename
}
quit
61>
Weighted Histogram Analysis Method - WHAM
WHAM is used extensively to calculate the free energy of a system along a properly chosen reaction coordinate in molecular dynamics simulations or monte carlo simulations. To be able to use WHAM you need to perform multiple simulations that cover the entire reaction coordinate to sample possible configurations. The choice of reaction coordinate constitutes a length discussion and is a topic of ongoing debate. So I encourage the reader to look it up elsewhere. After you have chosen a reaction coordinate and performed Umbrella Sampling or Free Energy Perturbation calculations, histograms corresponding to every window need to be extracted.
For the simple case of dragging a methane molecule from water into a lipid bilayer and out into water again, z axis is a good reaction coordinate if the lipid bilayer is on the x-y plane. With this set up, the z axis is split into discrete windows and the center of mass (COM) of the methane molecule is constrained (usually harmonic) to the center of every window. The length of windows and force constant of the constraint are chose such that the distribution of the z coordinate of the COM of methane overlaps with the distribution of the adjacent windows. This is a necessary prerequisite for using WHAM. Following the figure below, for a 60A long reaction coordinate a choice of 121 windows (each 0.5A and including both ends) will be plenty to ensure overlap of z coordinate distributions.
Collect z coordinate distributions and put them 121 files labeled window-001 to window-121.
Create a new file input.in that contains the following lines;
./window-001 -30.0 xx
./window-002 -29.5 xx
...
./window-120 +29.5 xx
./window-121 +30.0 xx
Here the first column is the file name, second is the mean value of that window and the third column needs to be filled with an integer but is irrelevant and not used by Alan Grossfield's implmentation of WHAM. Then run the following command
./wham 1 11 10 0.001 300 0 input.in freefile
where the inputs are
./wham hist.min hist.max num.bins tol Temp numpad infile outfile
The output contains a plot for the potential of mean force (PMF). Pay particular attention to units since they depend on your input. WHAM's documentation can be found here [http://membrane.urmc.rochester.edu/sites/default/files/wham/doc.html].
For the simple case of dragging a methane molecule from water into a lipid bilayer and out into water again, z axis is a good reaction coordinate if the lipid bilayer is on the x-y plane. With this set up, the z axis is split into discrete windows and the center of mass (COM) of the methane molecule is constrained (usually harmonic) to the center of every window. The length of windows and force constant of the constraint are chose such that the distribution of the z coordinate of the COM of methane overlaps with the distribution of the adjacent windows. This is a necessary prerequisite for using WHAM. Following the figure below, for a 60A long reaction coordinate a choice of 121 windows (each 0.5A and including both ends) will be plenty to ensure overlap of z coordinate distributions.
Collect z coordinate distributions and put them 121 files labeled window-001 to window-121.
Create a new file input.in that contains the following lines;
./window-001 -30.0 xx
./window-002 -29.5 xx
...
./window-120 +29.5 xx
./window-121 +30.0 xx
Here the first column is the file name, second is the mean value of that window and the third column needs to be filled with an integer but is irrelevant and not used by Alan Grossfield's implmentation of WHAM. Then run the following command
./wham 1 11 10 0.001 300 0 input.in freefile
where the inputs are
./wham hist.min hist.max num.bins tol Temp numpad
![]() |
| Figure Source: http://www.utdallas.edu/~son051000/comp/FreeE.pdf |
The output contains a plot for the potential of mean force (PMF). Pay particular attention to units since they depend on your input. WHAM's documentation can be found here [http://membrane.urmc.rochester.edu/sites/default/files/wham/doc.html].
Thursday, January 16, 2014
Ubuntu grub rescue
Following are my notes while I successfully recovered Ubuntu 12.04-LTS from grub recovery mode.
On a side note, if you ever accidentally delete /boot directory simply type the line below - just like this guy. Of course you need the find the appropriate linux-image-x.x.xx-xx-server and you do need to catch this blunder before rebooting.
I am using a Macbook Pro and trying to create a Ubuntu Live USB.
Create a Live USB using instructions from here.
http://www.ubuntu.com/download/desktop/create-a-usb-stick-on-mac-osx
This tells you how to work through grub rescue.
http://askubuntu.com/questions/197833/recovering-from-grub-rescue-crash
This video offers additional help
http://www.youtube.com/watch?v=8lod8sRb_6I
On a side note, if you ever accidentally delete /boot directory simply type the line below - just like this guy. Of course you need the find the appropriate linux-image-x.x.xx-xx-server and you do need to catch this blunder before rebooting.
sudo apt-get install --reinstall linux-image-2.6.32-42-server
Thursday, January 2, 2014
DNA simulation set-up with AMBER
I have been working on the structure and dynamics of single and double stranded DNA for some time now and below is a write up of an easy way to setup the simulations using the AMBER suite of software. Along with primary executables sander, pmemd, tleap and ptraj, AMBER comes with a number of other useful tools. One such tool is the nucleic acid builder (or nab). To create a 10mer poly-Adenosine poly-Thymidine, put the following text in a file called nuc.nab;
molecule m;
m = fd_helix( "abdna", "aaaaaaaaaa", "dna" );
putpdb( "nuc.pdb", m, "-wwpdb");
Then run these in the terminal
nab nuc.nab
./a.out
You should get a nuc.pdb file which contains the poly A-T double stranded DNA. Everything so far is available in more detail at http://ambermd.org/tutorials/basic/tutorial1/section2.htm
To get a single stranded poly-A DNA simply delete the lines corresponding to poly-T. To create stem-loop type configurations commonly found in RNA, do the following. Say you want the ssDNA
AAATAGAGCTAGTGAGGATTT
with the first 4 bp [AAAT] paired with the last 4 [TTTA or ATTT if you want to read from above]. For this I simply generate a double stranded DNA like so...
AAATAGAGCTAGTGAGGATTT
TTTATCTCGATCACTCCTAAA
Then delete the bases shown in red from the PDB file.
AAATAGAGCTAGTGAGGATTT
TTTATCTCGATCACTCCTAAA
Now you should have
AAATAGAGCTAGTGAGG
TTTA
This is the same as AAATAGAGCTAGTGAGGATTT but with the ends paired up. For the stem-loop conformation you should be able to use the parameter and topology files generated for the fully stretched single stranded DNA. You will have a long bond between AAATAGAGCTAGTGAGG--and--ATTT. But this can be easily fixed with a quick minimization.
molecule m;
m = fd_helix( "abdna", "aaaaaaaaaa", "dna" );
putpdb( "nuc.pdb", m, "-wwpdb");
Then run these in the terminal
nab nuc.nab
./a.out
You should get a nuc.pdb file which contains the poly A-T double stranded DNA. Everything so far is available in more detail at http://ambermd.org/tutorials/basic/tutorial1/section2.htm
To get a single stranded poly-A DNA simply delete the lines corresponding to poly-T. To create stem-loop type configurations commonly found in RNA, do the following. Say you want the ssDNA
AAATAGAGCTAGTGAGGATTT
with the first 4 bp [AAAT] paired with the last 4 [TTTA or ATTT if you want to read from above]. For this I simply generate a double stranded DNA like so...
AAATAGAGCTAGTGAGGATTT
TTTATCTCGATCACTCCTAAA
Then delete the bases shown in red from the PDB file.
AAATAGAGCTAGTGAGGATTT
TTTATCTCGATCACTCCTAAA
Now you should have
AAATAGAGCTAGTGAGG
TTTA
This is the same as AAATAGAGCTAGTGAGGATTT but with the ends paired up. For the stem-loop conformation you should be able to use the parameter and topology files generated for the fully stretched single stranded DNA. You will have a long bond between AAATAGAGCTAGTGAGG--and--ATTT. But this can be easily fixed with a quick minimization.
Subscribe to:
Posts (Atom)

